Part:BBa_J99000:Design
pSWK oriTRP4; [CmR]; oriVR6K; lambda_attP
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2209
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9
Illegal NotI site found at 2215 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2209
Illegal BglII site found at 917 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found at 2209
Illegal suffix found at 2 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found at 2209
Plasmid lacks a suffix.
Illegal XbaI site found at 2224
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NgoMIV site found at 2178 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Design Notes
attP recombination site of the lambda phage was PCR amplified with oligos 5'-TGGAGCTCAAATCAAATAATGATTTTATTT-3' and 5'-GCTGGAGCTCCATGGTACGCGTGCTAGAGGCA-3', and cloned at the SacI site of pSW23T (Demarre et al., 2005). The multiple cloning site was then replaced with the BioBrick strandard restriction sites through inverse PCR with oligos 'GCTTCTAGAGTACTAGTAGCGGCCGCTGCAGGCGGTGGAGCTCAAATCAAATAATG' and 'AGTACTCTAGAAGCGGCCGCGAATTCTATCAAGCTTATCGATACCGTCGACG'
Source
This plasmid was constructed from pSW23T (Demarre et al., 2005)
References
Demarre, G. et al. A new family of mobilizable suicide plasmids based on broad host range R388 plasmid (IncW) and RP4 plasmid (IncPalpha) conjugative machineries and their cognate Escherichia coli host strains. Research in microbiology 156, 245-55(2005).
Valens, M. et al. Macrodomain organization of the Escherichia coli chromosome. The EMBO journal 23, 4330-41(2004).